RESEARCH ARTICLE – Pharmaceutics, Drug Delivery and Pharmaceutical TechnologyQuantitative Analysis of Tissue Distribution of the B16BL6-Derived Exosomes Using a Streptavidin-Lactadherin Fusion Protein and Iodine-125-Labeled Biotin Derivative After Intravenous Injection in Mice
Section snippets
INTRODUCTION
Exosomes are small membrane vesicles that are secreted from various kinds of cells.1 It has been recently revealed that exosomes play key roles in various biological events, such as inflammation and tumor metastasis, because exosomes work as intercellular communication tools by transporting their components, including proteins and nucleic acids, to the cells receiving the exosomes.2., 3., 4., 5. Besides their biological roles, exosomes are attractive candidate vesicles for the delivery of these
Plasmid DNA
The cDNAs of SAV and murine LA were obtained as described in previous reports.12., 14. SAV-LA was constructed by replacing the epidermal growth factor-like domain of LA with SAV. The following primers were used for polymerase chain reaction: SAV (forward) 5′-GGATAGATCTCAGCATGCA GGTCTCCCGT-GTGCTGGCCGCGCTGTGCGGC ATGCTACTCTGCGCCT CTGGCCTCTTCGCCGGTGACCC CTCCAAGGACTC-3′, (reverse) 5′-TCCATGCCCAGCTGT GTAGAACAACCCTGCTGA ACGGCGTCGAGCG-3′ and LA (forward) 5′-TGTTCTACACA GCTGGGCATGGA-3', (reverse)
Modification of Exosomes with SAV-LA
Figure 1a shows the schematic diagram of LA and SAV-LA. Figure 1b shows the SAV concentration in each sample collected during the exosome purification steps. The SAV concentrations in the lysate and exosome fractions were approximately 118 and 42 nM, respectively. The SAV concentrations in the culture medium and UC supernatant fractions were below the detection limit (2 nM). As shown in Figure 1c, TEM observation revealed that biotin-coated gold nanoparticles were bound to the surface of the
DISCUSSION
Results obtained from the in vitro binding assay demonstrated that the exosomes collected from B16BL6 cells transfected with SAV-LA-expressing pDNA possessed binding capacity of SAV to biotin (Figs. 1b and 3). Moreover, TEM observation visualized the binding of SAV-LA-coupled exosomes to biotin-coated gold nanoparticles (Fig. 1c). As the molecules displayed on the outside of the exosomes are exposed to blood components, the reliability of the in vivo analysis based on the radioactivity would be
CONCLUSION
We demonstrated that 125I-labeled B16BL6 exosomes developed by SAV—biotin system is a useful method to obtain quantitative information about the pharmacokinetics of exogenously administered B16BL6-derived exosomes, which will be helpful for the development of exosome-based delivery systems.
ACKNOWLEDGMENTS
This work was partly supported by a Grant-in-Aid for Scientific Research (B) and a Grant-in-Aid for Exploratory Research from the Japan Society for the Promotion of Science (JSPS).
REFERENCES (30)
- et al.
Exosomes account for vesicle-mediated transcellular transport of activatable phospholipases and prostaglandins
J Lipid Res
(2010) - et al.
Treatment of brain inflammatory diseases by delivering exosome encapsulated anti-inflammatory drugs from the nasal region to the brain
Mol Ther
(2011) - et al.
Exosome display technology: Applications to the development of new diagnostics and therapeutics
Blood Cells Mol Dis
(2005) - et al.
Visualization and in vivo tracking of the exosomes of murine melanoma B16-BL6 cells in mice after intravenous injection
J Biotechnol
(2013) - et al.
Targeted delivery via avidin fusion protein: Intracellular fate of biotinylated doxorubicin derivative and cellular uptake kinetics and biodistribution of biotinylated liposomes
Eur J Pharm Sci
(2012) - et al.
Preparation and characterisation of antibody modified gelatin nanoparticles as drug carrier system for uptake in lymphocytes
Biomaterials
(2005) - et al.
Computational and mutagenesis studies of the streptavidin native dimer interface
J Mol Graph Model
(2010) - et al.
Exosomes are endogenous nanoparticles that can deliver biological information between cells
Adv Drug Deliv Rev
(2013) - et al.
Uptake of phosphatidylserine-containing liposomes by liver sinusoidal endothelial cells in the serum-free perfused rat liver
Biochim Biophys Acta
(2005) - et al.
Regulation of membrane trafficking and subcellular organization of endocytic compartments revealed with FM1—43 in resting and activated human T cells
Exp Cell Res
(2003)
Characteristics and biodistribution of cationic liposomes and their DNA complexes
J Control Release
Externalization of membrane-bound activities during sheep reticulocyte maturation is temperature and ATP dependent
Biochem Cell Biol
Membrane vesicles as conveyors of immune responses
Nat Rev Immunol
Maturation of reticulocytes: Formation of exosomes as a mechanism for shedding membrane proteins
Biochem Cell Biol
Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic phenotype through MET
Nat Med
Cited by (206)
Smart exosomes enhance PDAC targeted therapy
2024, Journal of Controlled ReleaseHypoxic regulation of extracellular vesicles: Implications for cancer therapy
2023, Journal of Controlled ReleaseEngineered mesenchymal stem cell-derived extracellular vesicles constitute a versatile platform for targeted drug delivery
2023, Journal of Controlled ReleaseImaging platforms to dissect the in vivo communication, biodistribution and controlled release of extracellular vesicles
2023, Journal of Controlled ReleasePhysio-chemical Modifications to Re-engineer Small Extracellular Vesicles for Targeted Anticancer Therapeutics Delivery and Imaging
2024, ACS Biomaterials Science and Engineering