Table 1

Real-time PCR primers

GeneForward primer (5-3)Reverse primer (5-3)
FGF21GCTGCTGGAGGACGGTTACACACAGGTCCCCAGGATGTTG
FGFR1CGCTCTACCTGGAGATCATTATAAAGAGGACCATCCTGTG
FGFR2CACCAACTGCACCAATGAACGGCTGGGTGAGATCCAAGTA
FGFR3CATCCGGCAGACATACACACTTCACTTCCACGTGCTTCAG
β-klothoTCCCCTGTGATTTCTCTTGGGAGCAATCTGTTGCCAGTGA
TNF-αTAGCCAGGAGGGAGAACAGACCAGTGAGTGAAAGGGACAGA
IL-1βTACATCAGCACCTCACAAGCAGAAACAGTCCAGCCCATACT
IL-6ACCAAGACCATCCAATTCATCCTGACCACAGTGAGGAATGTC
IL-17GTTCGTGCTATTGATTTTCAGCGGACCCCTTTACACCTTCTTT
IL-18AGGACACTTTCTTGCTTGCCACACAAACCCTCCCCACCTAAC
iNOSGGAATCTTGGAGCGAGTTGTGGATCCTCCAATCTCTGCCTATCCGTCT
IFN-γGTATTGCCAAGTTTGAGGTCAACGCTTCCTGAGGCTGGATTC
GAPDHTCACCACCATGGAGAAGGCGCTAAGCAGTTGGTGGTGCA
  • FGFR, fibroblast growth factor receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IFN-γ, interferon-γ; IL-6, interleukin 6; iNOS, inducible nitric oxide synthase; TNFα, tumour necrosis factor-α.